Monday, June 12, 2017

Last update

Sequence-indexed trDs and trAc insertions from bz-m2(D1) wx-m7(Ac)


tac/tds Site Ac/Ds insertion Chromosome Sequence Adjacent to TE's 5'-end (RC) Pseudomolecule Location Next to 5'-end of TE Ac/Ds orientation PCR Primer to Amplify TE's 5' Junction Gene Model Gene Description Where the sequence is located Primer name
913.41 Ac 1 143872661 Reverse
P5-Pr42*
907.12 Ac 1 162463336 Forward GTGCGCTGTCGAATCTCTCT GRMZM2G476637
Putative uncharacterized protein Within the gene P4-Pr9
914.19 Ds 1 179988314 Reverse
P5-Pr44*
931.13 Ac 1 185466444 Forward TGCACTGCCAGACAGTTTTC GRMZM2G134202
Putative uncharacterized protein Within the gene P12-Pr33
902.33 Ac 1 195332149 Forward GTTCTGGGACGTGATGGACT GRMZM2G136453
Putative uncharacterized protein Within the gene P1-Pr9
907.02 Ac 1 198745229 Forward
P4-Pr29
907.20 Ac 1 199111495 Reverse CTCTCATTGTCGCCTCTGC GRMZM2G113191
Carbonic anhydrase Intergenic region (.762 kbps away from gene) P4-Pr19
925.56 Ac 1 201189994 Forward CGATCATGACGAGAAAGCAA GRMZM2G004190
No gene function listed Within the gene P8-Pr3
935.01 Ds 1 225342760 Reverse
P14-Pr3
902.22 Ac 1 254253043 Reverse GGACTCGTTCAGACGACGAC GRMZM2G039074
Putative uncharacterized protein Within the gene P1-Pr5
922.05 Ds 1 275228176 Forward TCGCACCATCAGTGCTTATC GRMZM2G169671
TSA: Zea mays contig62594, mRNA sequence Intergenic region (1.046 kbps away from the gene) P10-PR14
919.14 Ds 1 296774733 Reverse AGAAGGGAGAGGAGGCAGGGTAGT GRMZM2G170137
Putative uncharacterized protein Within the gene P67-Pr17
906.19 Ds 1 297377325 Reverse TCACGCATGCAGCTCTACTT GRMZM2G369912
Putative uncharacterized protein Within the gene P3-Pr11
922.09 Ac 1 30041870 Reverse TCGCCCAACCTACTGAATCT GRMZM5G896413
No gene function listed Intergenic region (.455 kbps away from the gene) P10-PR17
915.05 Ds 1 43126543 Forward
P5-Pr25
907.73 Ac 1 45515469 Forward
P4-Pr25*
907.38 Ac 1 47474757 Reverse CTCCTCCGACCCTTTTCAC GRMZM2G300685
No gene function listed Within the gene P4-Pr2
907.37 Ac 1 47597170 Reverse AAACACGAGCCACGAGAACT GRMZM2G427418
Transcribed locus, moderately similar to NP_001168327.1 hypothetical protein LOC100382095 [Zea mays] Intergenic region (.089 kbps away from gene ) P4-Pr1
917.11 Ds 1 53164931 Forward CAAGCGACCACTCCAAAAAC GRMZM2G107481
Putative uncharacterized protein Intergenic region (.010 kbps away from the gene) P9-Pr8
921.26 Ds 1 54277901 Reverse GAAGTACATGACGCCCTGGT GRMZM2G023715
Putative uncharacterized protein Within the gene P8-Pr18
923.08 Ac 1 6834053 Reverse GRMZM2G092916
No gene function listed Within the gene known
922.09 Ds 1 81390941 Reverse
P10-PR16
901.32 Ds 1 9807083 Reverse GAGCCTGAAGAACTCGCTGT GRMZM2G009818
Transcribed locus, weakly similar to NP_001053257.1 Os04g0506100 [Oryza sativa Japonica Group] Within the gene P1-Pr7
931.08 Ds 1 98761179 Forward CTTCCTCCCTCGGAGAGACT GRMZM2G094168
Putative uncharacterized protein Intergenic region (.124 kbps away from the gene) P12-Pr14
935.05 Ac 2 10626170 Forward
P14-Pr4
906.73 Ds 2 167363518 Forward GCGGGTCCAATAACCAATTA GRMZM5G872070
Full-length cDNA clone ZM_BFb0236O04 Within the gene P3-Pr12
907.43 Ac 2 17875575 Reverse CTCGATCTCAATGGAACACG GRMZM2G027891
No gene function listed Intergenic region (4.045 kbps away from gene ) P4-Pr3
911.02 Ac 2 180667651 Reverse
P4-Pr30
905.73 Ac 2 181548070 Reverse
P2-Xpr7
919.39 Ac 2 222681316 Reverse TTGCCCGTAAATTCGCATA GRMZM2G015933
BRASSINOSTEROID INSENSITIVE 1-associated receptor kinase 1 Within the gene P67-Pr6
923.17 Ac 2 228859281 Forward GRMZM2G150383
Putative uncharacterized protein Within the gene known
923.27 Ac 2 27122695 Reverse ATCAACACGGCTTATCGAGT GRMZM2G024196
TSA: Zea mays contig19269, mRNA sequence Within the gene P10-PR6
918.02 Ac 2 28125899 Reverse GRMZM2G483501
No gene function listed Intergenic region (2.722 kbps away from the gene) known 3'
934.37 Ac 2 28316148 Reverse
P14-Pr8
906.52 Ac 2 29521919 Reverse CTTTCGCCTGCTTCATCTTC GRMZM2G048366
Putative uncharacterized protein Within the gene P3-Pr1
935.55 Ac 2 44195399 Reverse
P14-Pr15
923.41 Ac 2 47047773 Reverse
P10-PR35
907.62 Ac 2 6190937 Forward CCCTTGTCCATGTGAGCTTC GRMZM2G072820
Transcribed locus, strongly similar to XP_002448623.1 hypothetical protein SORBIDRAFT_06g030340 [Sorghum bicolor] Within the gene P4-Pr10
903.05 Ac 3 10387692 Forward GRMZM2G483032
No gene function listed Intergenic region (1.081 kbps away from the gene) 3'-end
925.16 Ds 3 11651267 Reverse GCGTACCGATCATGAATGC GRMZM2G336437
Lactoylglutathione lyase Within the gene P8-Pr24*
905.87 Ds 3 148834668 Forward GCTCGTTTGGCCAAGTCTAT GRMZM2G047310
Putative uncharacterized protein Within the gene P2-Pr23
901.09 Ds 3 155964091 Forward TGTTCGGCCCAGTACTTCAT GRMZM2G161295
Putative uncharacterized protein Intergenic region (.928 kbps away from gene) P1-Pr38
907.32 Ac 3 156362262 Reverse CAAGCAAGTCCTACAATGTCCA GRMZM2G173534
Inducer of CBF expression 2 Intergenic region (.100 kbps away from gene ) P4-Pr7
901.01 Ac 3 159806897 Forward
P1-Pr45
915.07 Ac 3 167074371 Forward
P5-Pr17
931.22 Ds 3 172442566 Forward
P12-Pr48
907.01 Ds 3 176326781 Forward GTCCAAGATCCTCCCAGGTC GRMZM2G074229
No gene function listed Intergenic region (4.171 kbps away from the gene) P3-Pr3
933.6 Ds 3 189461670 Reverse CCACACGGACTAACCTCCAT GRMZM2G702070
Clone 484277 mRNA sequence Intergenic region (2.962 kbps away from the gene) P9-Pr35
906.59 Ac 3 201191485 Reverse CACTGGCTTGCTAGGGAAGG GRMZM2G589538
Transcribed locus Intergenic region (1.019 kbps away from the gene) P3-Pr24
923.13 Ac 3 202040226 Reverse TTGTAAGGGGAATAGCGAGGT GRMZM2G158013
Putative uncharacterized protein Within the gene P10-PR4
930.06 Ac 3 212116930 Reverse CAGTTGCATGGCCACCTATT GRMZM2G577756
Transcribed locus Source: UniGene Zm. Within the intron in the gene P12-Pr17
902.26 Ac 3 230670836 Reverse GGGCACATCTCTTCTCTTGC GRMZM2G011878
Putative uncharacterized protein Within the gene P1-Pr1
905.92 Ac 3 28336805 Reverse GGAACCAGAGTGAGCAGGAG GRMZM2G076104
Putative uncharacterized protein Intergenic region (.576 kbps away from gene) P2-Pr25
921.38 Ds 3 4337629 Reverse GGTCTCAGCTCCTCGAAATG GRMZM2G346466
Transcribed locus, weakly similar to XP_002266057.1 PREDICTED: hypothetical protein [Vitis vinifera] Within the gene P10-PR3
919.32 Ds 3 5880174 Reverse AGTTTGGGCTTTCTATGCGTCGTC GRMZM2G143723
Transcribed locus, moderately similar to XP_002457187.1 hypothetical protein SORBIDRAFT_03g002960 [Sorghum bicolor Intergenic region (4.076 kbps away from gene) P67-Pr19
902.13 Ac 4 112454645 Forward GACGGACAGTGTACCCGATT GRMZM2G156322
No gene function listed Intergenic region (34.16 kbps away from gene) P1-Pr23
911.05 Ac 4 122293522 Reverse CAAGCAGCGTAGAAGAACTGC GRMZM2G081359
Putative uncharacterized protein Intergenic region (37.352 kbps away from gene) P4-Pr8
904.03 Ds 4 144525848 Reverse CCAAGAGGGTCTCATTGTCAG GRMZM2G038820
Putative uncharacterized protein Intergenic region(1.451 kbps away from the gene) P3-Pr2
922.24 Ac 4 145246116 Forward CACCGACGGTAAAAACACG GRMZM2G165519
No gene function listed Intergenic region (.589 kbps away from the gene) P10-PR9
914.26 Ac 4 152530674 Forward
P5-Pr6
925.28 Ac 4 158605779 Forward GCCTCGCATCGACCAGTT GRMZM2G106931
No gene function listed Within the gene P10-PR21
919.26 Ac 4 175424123 Forward GTGCGTACGAGGGAAGAGG AC204383.2_FG002
No gene function listed Intergenic region (1.199 kbps away from gene) P67-Pr11
902.24 Ac 4 185315106 Forward GGCTTGTCCAGGTGACTGAT GRMZM2G131516
Protein SCARECROW (ZmSCR) Intergenic region (3.5 kbps away from gene) P1-Pr13
907.74 Ds 4 200026581 Reverse ACACACTGTCTGTGCGTTCC GRMZM2G581755
No gene function listed Intergenic region (3.904 kbps away from gene) P4-Pr13
934.07 Ac 4 210664744 Forward ATCCAGCAAACACTCAAAGCA GRMZM2G397403
No gene function listed Intergenic region (3.857 kbps away from the gene) P12-Pr30
919.05 Ac 4 228624458 Forward GCCGGGAAGACCAGAAGAAAGAA GRMZM2G020196
Transcribed locus, strongly similar to XP_002451836.1 hypothetical protein SORBIDRAFT_04g008430 [Sorghum bicolor] Intergenic region (.063 kbps away from the gene) P67-Pr23
931.10 Ds 4 236904175 Forward GACTGCATGCCTGTAGCTGT GRMZM2G419994
Wound induced protein Part of the only exon, contains the TGA stop codons, and goes into the 3'UTR P12-Pr3
901.15 Ds 4 237147607 Forward
P1-Pr3
911.02 Ac 4 237688153 Reverse
P5-Pr2
919.19 Ds 4 3266789 Forward GCACGCTACCCGCCGAGGAGA GRMZM2G085854
Hydroquinone glucosyltransferase Within the gene P67-Pr26
907.01 Ds 4 37731735 Reverse CATCTTGAAGGCGGTAGGAG GRMZM2G434240
No gene function listed Within the gene P3-Pr8
904.04 Ac 5 116910168 Reverse CTGGGATGGAGATGGTCGAG GRMZM2G470666
No gene function listed Within the gene P3-Pr6
934.12 Ac 5 126774430 Reverse
P14-Pr6
931.11 Ac 5 136203049 Forward CAAGGGTGAGGCTTTCGAC GRMZM2G449019
No gene function listed Intergenic region (1.932 kbps away from the gene) P12-Pr23
902.05 Ac 5 15445966 Forward GRMZM2G340578
No gene function listed Intergenic region (.908 kbps away from the gene) 3'-end
931.14 Ac 5 155095638 Reverse
P12-Pr41
914.07 Ac 5 164859654 Reverse GRMZM5G872392
Hypothetical protein LOC100280206 Intergenic region (.238 kbps away from the gene) known 3'
907.02 Ac 5 18672546 Forward CGGCATGGGTAAGATTCAAC GRMZM2G487300
No gene function listed Intergenic region (2.331 kbps away from the gene) P3-Pr15
907.16 Ds 5 201232514 Reverse ATCCCTGCCTGCCGTAGTA GRMZM2G417229
hypothetical protein LOC100279191 (LOC100279191), mRNA Intergenic region (4.331kbps away from gene) P4-Pr21
931.23 Ds 5 20490408 Reverse TCTCGAACCTGGAGATGGAG GRMZM2G080231
Putative uncharacterized protein part of the 2nd intron and the 3rd exon within the gene P12-Pr19
919.41 Ac 5 21933865 Forward GCCTGTGCGCTTCCCGTCTA GRMZM2G096372
Clone 264517 mRNA sequence Within the gene, but 84 bps of the sequence fall into the intergenic region after the gene P67-Pr21
907.51 Ac 5 3146628 Forward GRMZM2G332976
Sex determination protein tasselseed-2 Within the gene known 3'
921.30 Ds 5 43662478 Reverse GCGTTGCAAATGAGCTAGGA GRMZM2G312578
No gene function listed Intergenic region (4.487 kbps away from the gene) P8-Pr4
907.25 Ac 5 45334411 Forward GRMZM2G067789
TSA: Zea mays cultivar W22 CL571Contig1.betc, mRNA sequence Within the gene known 3'
911.30 Ac 5 51355174 Forward GRMZM2G457211
No gene function listed Within the gene known 3'
934.08 Ds 5 53908064 Forward CAGTGCACGGTTTTGACAAT GRMZM2G026980_T01
Putative uncharacterized protein Xyloglucan endo-transglycosylase homolog Xyloglucan endotransglucosylase/hydrolase protein 23 3' UTR within the gene P12-Pr1
919.17 Ds 5 63229876 Forward CAGAAGCCCCAGGCGTAG GRMZM2G064360
Basic endochitinase 1 Within the gene P67-Pr5
919.17 Ds 5 63634507 Forward CAATTGTAGTCGCCAGAGTTTCAG GRMZM2G028501
Intergenic region ( 847 bp away from gene) P67-Pr10
905.16 Ds 5 6529237 Reverse
P2-Xpr2
914.02 Ac 5 6680733 Forward
P5-Pr43*
914.12 Ac 5 7141363 Forward
P5-Pr22
905.84 Ac 5 73110632 Reverse
P2-Xpr5
923.04 Ac 5 99923758 Forward
P10-PR19
923.01 Ds 6 120452121 Forward
P10-PR26
930.07 Ac 6 138658349 Reverse
P12-Pr50
922.05 Ac 6 147525627 Reverse CCAGCTAGCGAAATCGAAAC GRMZM2G147867
Putative uncharacterized protein Intergenic region (10.600 kbps away from the gene) P10-PR1
934.21 Ac 6 150678740 Forward
P14-Pr7
931.12 Ac 6 152142578 Forward GCACAGATTTTGGGGTTCAT GRMZM2G134753_T01
Putative uncharacterized protein 19bps are within intron 11, the rest of the sequence is within exon 12 P12-Pr4
923.47 Ds 6 152849135 Reverse
P10-PR25
934.20 Ac 6 4621135 Forward
P14-Pr23
931.06 Ac 6 656694 Reverse TATGCTGGTTGCTGATTGCT GRMZM2G358540
VAMP protein SEC22 Within the gene P12-Pr27
925.04 Ds 6 NSS CACCACCGTCTTGACATTTCT
P10-PR22
935.04 Ac 7 126226498 Reverse
P14-Pr12
935.37 Ac 7 133565843 Forward
P14-Pr14
903.06 Ac 7 147418063 GRMZM2G042429
SAUR52-auxin-responsive SAUR family member Within the gene 3'-end
931.17 Ac 7 152746077 Reverse GGTTGGTTGGTTGGTAAAGG GRMZM2G121546
Putative uncharacterized protein Intergenic region ( 3.995 kbps away from the gene) P12-Pr25
931.11 Ds 7 160992038 Reverse ACTTGACACGACAGCTACGC GRMZM2G550596
No gene function listed Intergenic region (37.638 kbps away from the gene) P12-Pr26
930.04 Ac 7 164607070 Reverse GTGGCGGAAGGAATAAACTG AC187072.4_FG002
No gene function listed Intergenic region (.041 kbps away from the gene) P12-Pr28
913.09 Ac 7 167042537 Reverse GRMZM2G427408
Clone 402894 mRNA sequence Within the gene known 3'
923.32 Ac 7 170994630 Reverse GGGTTCTTACGTTTCGAGCA GRMZM2G036113
Putative uncharacterized protein Intergenic region (1.123 kbps away from the gene) P10-PR10
929.28 Ds 7 173187340 Forward CGTGGATGTGGTGGGACTAC GRMZM5G881387
Putative uncharacterized protein Within exon 2 in the gene P12-Pr13
902.34 Ac 7 176025858 Forward GATCAGGTCGAAGGTTCACA GRMZM2G525718
No gene function listed 22bps are within the gene, the remaining 144 are within an intergenic region P1-Pr39
914.25 Ds 7 4110328 Forward
P5-Pr23
905.60 Ds 7 4260898 Reverse AGATCCGTTTCGGCATACAG GRMZM2G365875
No gene function listed Within the gene P2-Pr4
907.49 Ac 7 4547477 Reverse GRMZM2G180011
Clone 287630 mRNA sequence Within the gene known 3'
931.11 Ac 7 85882314 Forward ATCAAGCACATCGTCACCAG GRMZM2G088849
Putative uncharacterized protein Within the gene P12-Pr21
902.19 Ds 7 NSS
P1-Pr32
903.23 Ds 8 11107625 Forward GATCATTGTGCGTTGTGAGC GRMZM2G090114
No gene function listed Intergenic region (1.61 kbps away from gene) P1-Pr25
919.25 Ac 8 119722282 Reverse GTATGTGTTGCGCAGGTGTCTC GRMZM2G161009
BZIP transcription factor Putative uncharacterized protein Within the gene P67-Pr18
935.37 Ac 8 123060610 Reverse
P14-Pr11
911.22 Ac 8 130212184 Forward GRMZM2G178686
Putative uncharacterized protein Within the gene known 3'
935.50 Ac 8 146148438 Reverse
P14-Pr20
911.16 Ac 8 151219586 Forward GRMZM2G077054
Transcribed locus, strongly similar to XP_002458326.1 hypothetical protein SORBIDRAFT_03g031310 [Sorghum bicolor] Intergenic region (3.914 kbps away from the gene) known
910.01 Ac 8 151219593 Reverse CTCTGCAGTCTGCGTTAACATC GRMZM2G077054
Transcribed locus, strongly similar to XP_002458326.1 hypothetical protein SORBIDRAFT_03g031310 [Sorghum bicolor] Intergenic region (3.921 kbps away from gene) P4-Pr11
907.40 Ds 8 1641075 Forward CACCGACATATGCAGAGACATC GRMZM2G030280
Putative uncharacterized protein Within the gene P4-Pr5
907.58 Ds 8 1641075 Forward CACCGACATATGCAGAGACATC GRMZM2G030280
Putative uncharacterized protein Within the gene P4-Pr5
907.44 Ac 8 164631269 Reverse
P4-Pr27
902.27 Ac 8 166241430 Forward TCGCACTGTGACACTTCCTC GRMZM2G173715
No gene function listed Within the gene P1-Pr11
917.19 Ac 8 170180140 Reverse
P9-Pr6
933.81 Ds 8 170180140 Reverse CAGAGCTGACTGCTGACTCG GRMZM2G495996
No gene function listed Intergenic region (9.441 kbps away from the gene) P9-Pr6
911.14 Ac 8 171608052 Reverse GRMZM2G132303
No gene function listed Within the gene known5'
921.23 Ds 8 171802110 Reverse
P8-Pr35
907.54 Ac 8 173609195 Forward GRMZM2G406155
No gene function listed Within the gene known 3'
934.08 Ds 8 18447222 Forward CCTTCAGCTGCATCACTTGT GRMZM2G504652
No gene function listed Intergenic region ( .015 kbps away from the gene) P12-Pr12
934.09 Ds 8 25333817 Reverse
P14-Pr5
921.18 Ds 8 5721316 Reverse ACGTCCAGGTACAGGTTGTTG GRMZM2G323558
Pectin esterase inhibitor domain containing protein Within the gene P8-Pr10
902.13 Ac 8 63801974 Reverse CAGAGAAGGGCAGCGACTAT GRMZM2G539365
No gene function listed Intergenic region (.517 kbps away from gene) P1-Pr31
905.23 Ac 9 101655482 Forward GCACCCCCTAGTTTGTCTCA GRMZM2G146481
Transcribed locus Intergenic region (25.900 kbps away from gene) P2-Pr30
931.12 Ds 9 102940231 Reverse TACCTTGCTCAGAGCCGTTG GRMZM2G152120
No gene function listed Part of exon 4 within the gene P12-Pr2
917.10 Ds 9 102983494 Reverse AGGTCGACGTCATCACCTTT GRMZM2G152126
Putative uncharacterized protein Intergenic region (19.800 kbps away from the gene) P9-Pr10
914.25 Ac 9 105421651 Forward
P5-Pr41*
925.03 Ac 9 106624268 Reverse
P10-PR27
902.08 Ac 9 106631679 Forward
P1-Pr43
914.27 Ac 9 113471385 Reverse
P5-Pr1
925.54 Ds 9 11397647 Reverse GTGTTCTTCAGGGGTTTGGT GRMZM2G070475
TSA: Zea mays contig42254, mRNA sequence Within the gene P8-Pr11
922.22 Ds 9 11739763 Reverse TCAGGACATGAATGCCAGTT GRMZM2G177218
Hypro1Putative uncharacterized protein hypro1 Within the gene P10-PR20
922.02 Ds 9 11748028 Reverse TGCCTAAACAACAACGTAGCA GRMZM2G177098
60S ribosomal protein L33-BRibosomal protein L35A Within the gene P10-PR15
929.19 Ds 9 11777576 Reverse
P12-Pr42
902.22 Ds 9 11778891 Forward
P1-Pr2
914.25 Ds 9 11779405 Forward
P5-Pr32
901.03 Ds 9 11920754 Forward GAGGAGGTGCTCGATACCAT GRMZM2G061472
Putative uncharacterized protein hypro4 Within the gene P1-Pr19
925.20 Ds 9 11929596 Reverse TCGGGTTCTATCCTCCATCA GRMZM5G834697
Putative uncharacterized protein Within the gene P8-Pr15
914.13 Ac 9 122942004 Forward GRMZM2G359314
No gene function listed Intergenic region (2.091 kbps away from the gene) known 5'
902.07 Ac 9 12331428 Forward GRMZM2G151913
No gene function listed Within the gene P1-Pr15
915.06 Ac 9 124241992 Reverse
P5-Pr31
921.01 Ds 9 12597432 Reverse GGCTGCTCTTTGATGGTAGG GRMZM2G428370
No gene function listed Intergenic region (.786 kbps away from the gene) P10-PR11
934.41 Ds 9 12597537 Forward
P14-Pr13
902.04 Ac 9 126185395 Reverse
P1-Pr15
929.2 Ac 9 128768790 Reverse
known
933.17 Ac 9 130641549 Reverse ACGCGAACGCTATCCTTTAG GRMZM2G025370
No gene function listed 30 bps are within the gene, the remaining bps fall into the intergenic region before the gene. P9-Pr3
933.36 Ac 9 130641549 Reverse ACGCGAACGCTATCCTTTAG GRMZM2G025370
No gene function listed 30 bps are within the gene, the remaining bps fall into the intergenic region before the gene. P9-Pr3
929.37 Ds 9 131520541 Reverse CAAGGTCTCGTTTCCGTCTG GRMZM2G027499
Found within exon 3 in the gene P12-Pr8
906.62 Ac 9 13445578 Reverse TGGAATATGCTGTGGTACGG GRMZM2G409865
TSA: Zea mays contig41959, mRNA sequence Within the gene P3-Pr19
905.62 Ds 9 13454132 Reverse TTGAACGCTATGTCCACCAA GRMZM2G109612
No gene function listed Intergenic region (.165 kbps away from gene) P2-Pr13
915.17 Ac 9 136177940 Forward
P5-Pr33
903.24 Ac 9 138243496 Forward AGTACGCACGGCTAGCTACA GRMZM2G118959
Transcribed locus, moderately similar to NP_001147664.1 beta3-glucuronyltransferase [Zea mays] Within the gene P1-Pr21
902.08 Ds 9 139512628 Forward TGAACTCCATCACGAAGTGG GRMZM2G366532
Putative uncharacterized protein Within the gene P1-Pr34
934.24 Ds 9 141540529 Forward
P14-Pr21
929.09 Ac 9 14457555 Forward GTCGGTTTGACGACCTTGAC GRMZM2G159822
No gene function listed Within the gene P12-Pr20
921.25 Ds 9 145348910 Reverse TCCTGCCCCTGGAAGTAGTA GRMZM2G067225
Putative uncharacterized protein Within the gene P8-Pr9
925.37 Ac 9 145757288 Forward CTACTACAGCCGCACTCAAGC GRMZM2G328268
No gene function listed Intergenic region (3.133 kbps away from the gene) P8-Pr6
913.11 Ac 9 145757401 Forward
P5-Pr14*
913.39 Ac 9 145757401 Forward
P5-Pr14*
905.45 Ac 9 145757473 Forward GTAGTGGCCACCAACTTCCA GRMZM2G328254
No gene function listed Intergenic region (.462 kbps away from gene) P2-Pr5
906.67 Ac 9 145769559 Reverse
P3-Pr9-2
906.06 Ac 9 14585091 Forward
P3-Pr25
917.04 Ds 9 149753738 Reverse CTGTTCTTGAGGGCGATCTG GRMZM2G095786
Putative uncharacterized protein Intergenic region (1.680 kbps away from the gene) P9-Pr4
935.31 Ac 9 153508824 Forward
P14-Pr2
919.03 Ac 9 15692377 Reverse TCAGCCACCCTTTGCCGACGAA GRMZM5G810393
Cytochrome P450 CYP94D27 Within the gene P67-Pr29
922.26 Ac 9 15693547 Forward CCACGGCTCACAGTACAAAG GRMZM5G810393
Cytochrome P450 CYP94D27 Within the gene, but 45 bps fall into the intergenic region after the gene P10-PR12
929.23 Ac 9 15702564 Reverse TCCAACAATCCTTCATCGTG GRMZM2G102302
No gene function listed Intergenic region (1.881 kbps away from the gene) P12-Pr34
906.27 Ac 9 15976653 Forward GAGGTGCTTCCCTGCAAATA GRMZM2G304378
36.4 kDa proline-rich protein Proline rich protein Putative uncharacterized protein Within the gene P3-Pr4
933.01 Ds 9 16179666 Reverse TCCTATCGTATTCAGGTGCTCA GRMZM2G104747
Putative uncharacterized protein Within the gene P12-Pr40
905.27 Ac 9 16182817 Reverse CGTATCCAGTTCCTCTGCAA GRMZM2G104760
Putative uncharacterized protein Within the gene P3-Pr20
917.27 Ac 9 16726124 Reverse GRMZM2G160496
No gene function listed Within the gene known 3'
921.36 Ac 9 17102091 Reverse
P10-PR5
906.03 Ac 9 17478852 Forward CGATCTACCCCGGTCATAGT GRMZM2G162420
Putative uncharacterized protein Within the gene P3-Pr5
913.01 Ac 9 18620697 Forward GRMZM2G052562
Alpha-L-fucosidase 2Putative uncharacterized protein Intergenic region (2.408 kbps away from the gene) known 3'
934.27 Ac 9 18873093 Forward
P14-Pr10
921.03 Ds 9 19802795 Forward GGATCGCAGAACGAACACAT GRMZM2G077040
Putative uncharacterized protein Within the gene P8-Pr13
905.41 Ac 9 19985670 Reverse ACCCTGGACGGAAGTAATCC GRMZM2G561335
No gene function listed Intergenic region (1.698 kbps away from the gene) P3-Pr21
905.51 Ac 9 19985670 Forward
P3-Pr21
933.78 Ac 9 20324980 Reverse AGCAGCGACATGTCCACTTA GRMZM2G444801
Putative uncharacterized protein Sulfate transporter 3.4 Intergenic region (8.839 kbps away from the gene) P9-Pr32
901.20 Ac 9 20331039 Forward GCAATTGGTGGGGTAAGTTC GRMZM2G444801
Putative uncharacterized protein Sulfate transporter 3.4 Intergenic region (2.64 kbps away from gene) P1-Pr27
925.48 Ac 9 20334700 Reverse GCGCAATAACTGACTGGTTG GRMZM2G444801
Putative uncharacterized protein Sulfate transporter 3.4 Within the gene P8-Pr7
905.03 Ac 9 20334725 Forward TACGATTTTGCTGGCAGGAC GRMZM2G444801
Putative uncharacterized protein Sulfate transporter 3.4 Within the gene P2-Pr3
933.47 Ac 9 20594702 Reverse CTACGGGATGGTGCTTATGG GRMZM2G391473
Clone 1584105 mRNA sequence Within the gene P9-Pr12
933.47 Ac 9 20666275 Forward CACTGAGATGGAACGCTACG GRMZM2G147399
Early nodulin 93 Within the gene P9-Pr14
913.14 Ac 9 20667666 Reverse GRMZM2G147399
Early nodulin 93 Intergenic region (.221 kbps away from the gene) known 3'
929.14 Ac 9 20748100 Reverse GATCCCTTTCTTTCAGCAGGT GRMZM2G404965
Putative uncharacterized protein Within the gene P12-Pr39
929.29 Ac 9 20825413 Reverse TCGACGATGGTCAAGGACAC GRMZM2G433433
No gene function listed Within the gene P12-Pr22
914.18 Ac 9 21333433 Reverse
P5-Pr28
905.47 Ac 9 21727550 Reverse CGTTCCGGATTCAGACTGTT GRMZM2G115124
GDP-mannose 4,6 dehydratase 2 Within the gene P2-Pr14
917.03 Ac 9 21727632 Forward ATCAGACAGGCGTTTCATCC GRMZM2G115124
GDP-mannose 4,6 dehydratase 2 Within the gene, but 19 bps fall into the intergenic region after the gene. P9-Pr23
921.21 Ac 9 21817499 Reverse TCCAAGCTAGTCCGAACCTC GRMZM2G144421
Hypothetical protein LOC100382171 Intergenic region (5.364 kbps away from the gene) P8-Pr5
902.11 Ds 9 21817511 Forward GCGATGTGATAGATGCGACT GRMZM2G144421
Hypothetical protein LOC100382171 Intergenic region (5.58 kbps away from gene) P1-Pr35
925.53 Ds 9 22069285 Reverse
P8-Pr34
905.55 Ac 9 22324803 Reverse GATGATGGGTGACCATGACA GRMZM2G107609
Putative uncharacterized protein Within the gene P2-Pr2
917.11 Ac 9 22685620 Forward TGCATGGGCTACTCTATTCC GRMZM5G877500
3-phosphoshikimate 1-carboxyvinyltransferase Fragment (EC 2.5.1.19) Intergenic region (4.358 kbps away from the gene) P9-Pr36
903.2 Ac 9 22784640 Reverse TTTTGGCTCTGGAGTTGGAG GRMZM2G033208
Transketolase, chloroplastic (TK)(EC 2.2.1.1) Intergenic region (.626 kbps away from gene) P1-Pr29
933.06 Ac 9 22831744 Forward CCCAGACACATGCAATCTAGC GRMZM2G556883
Transcribed locus Intergenic region (.135 kbps away from the gene) P9-Pr21
905.39 Ac 9 22891006 Forward
P2-Pr17
919.37 Ac 9 22891780 Reverse TGAACTTGTCCATGCTACCC GRMZM2G504297
No gene function listed Intergenic region (26.896 kbps away from gene) P67-Pr4
905.40 Ac 9 23056092 Reverse GCACGGATTTGGTAGGAGAA GRMZM2G010723
Clone 287908 mRNA sequence 67 bps of the sequence are within the gene, the remaining base pairs are part of the intergenic region after the gene. P2-Pr7
913.35 Ac 9 23059121 Reverse
P5-Pr19
933.10 Ac 9 23059339 Forward
P9-Pr17
933.32 Ac 9 23059339 Forward
P9-Pr17
933.67 Ac 9 23059339 Forward
P9-Pr17
921.11 Ac 9 23061055 Reverse
P8-Pr36
925.41 Ac 9 23061055 Reverse
P8-Pr36
905.46 Ac 9 23088647 Reverse CCAAGGTCCTATTTCGATGC GRMZM2G522411
No gene function listed Intergenic region (4.88 kbps away from gene) P2-Pr9
905.69 Ac 9 23123333 Forward AAATGTGCATGTCGCTTCTG GRMZM2G567124
No gene function listed Intergenic region (1.042 kbps away from gene) P2-P31
909.06 Ac 9 23134922 Reverse GRMZM2G321076
No gene function listed Intergenic region (1.772 kbps away from the gene) known 3'
933.12 Ac 9 23134962 Forward CTAGAACGGCATCCATGGTC GRMZM2G321076
No gene function listed Intergenic region (1.597 kbps away from the gene) P9-Pr7
903.09 Ac 9 23145436 Forward CTTCGGAGGGAGTAGCACAG GRMZM2G019356
Transcribed locus, strongly similar to XP_002436422.1 hypothetical protein SORBIDRAFT_10g002190 [Sorghum bicolor] Within the gene P1-Pr33
934.33 Ac 9 23146233 Forward
P14-Pr16
905.85 Ac 9 23147558 Reverse AGCGAAGAGGACAAGAAACG GRMZM2G019356
Transcribed locus, strongly similar to XP_002436422.1 hypothetical protein SORBIDRAFT_10g002190 [Sorghum bicolor] Intergenic region (.182 kbps away from gene) P2-P37
933.37 Ac 9 23209077 Reverse ATATAGCTGGGCTGCGAGTC GRMZM2G404608
Putative uncharacterized protein 9C20.6b Intergenic region (.725 kbps away from the gene) P9-Pr13
925.22 Ac 9 23210556 Forward GACGGATTTGTTGTGCACTG GRMZM2G404603
Putative uncharacterized protein 9C20.6a Within the gene P8-Pr1
921.32 Ac 9 23210705 Forward GACGGATTTGTTGTGCACTG GRMZM2G404603
Putative uncharacterized protein 9C20.6a Within the gene P8-Pr1
909.01 Ac 9 23211452 Forward GACACGGCTCCTTTAAAAACC GRMZM2G404603
Putative uncharacterized protein 9C20.6a Within the gene P4-Pr15
929.12 Ac 9 23211807 Reverse AAGCGACGACTGTGTGAGG GRMZM2G404603
Putative uncharacterized protein 9C20.6a Intergenic region (.237 kbps away from the gene) P12-Pr15
917.14 Ac 9 23212726 Forward AAAGCACGGTAGGGTAGTGG GRMZM2G404603
Putative uncharacterized protein 9C20.6a Intergenic region 91.156 kbps away from the gene) P9-Pr26
905.32 Ac 9 23215613 Forward CAGAGCACTCCAGCACACTC GRMZM2G404599
Putative uncharacterized protein Intergenic region (.320 kbps away from gene) P2-Pr1
933.07 Ac 9 23256846 Reverse GTCCAACATGTTTGCACCAC GRMZM2G024993
Granule-bound starch synthase 1, chloroplastic/amyloplastic Precursor (EC 2.4.1.242)(Granule-bound starch synthase I)(GBSS-I) Within the gene P9-Pr24
921.1 Ac 9 23257992 Forward
P8-Pr25
914.23 Ac 9 23258854 Forward GRMZM2G024993
Granule-bound starch synthase 1, chloroplastic/amyloplastic Precursor (EC 2.4.1.242)(Granule-bound starch synthase I)(GBSS-I) Within the gene known 3'
921.07 Ac 9 23260732 Reverse GACCAAGGCGTGTGACAAT GRMZM2G024993
Granule-bound starch synthase 1, chloroplastic/amyloplastic Precursor (EC 2.4.1.242)(Granule-bound starch synthase I)(GBSS-I) Intergenic region (.339 kbps away from the gene) P8-Pr12
905.42 Ac 9 23261338 Forward
P2-P55
905.88 Ac 9 23261338 Forward GAAGCCCTGATAAACTGTCTGG GRMZM2G024993
Granule-bound starch synthase 1, chloroplastic/amyloplastic Precursor (EC 2.4.1.242)(Granule-bound starch synthase I)(GBSS-I) Intergenic region (1.102 kbps away from gene) P2-P55
925.54 Ac 9 23261547 Reverse GGGCTTCTTGACTGCTGAAT GRMZM2G024993
Granule-bound starch synthase 1, chloroplastic/amyloplastic Precursor (EC 2.4.1.242)(Granule-bound starch synthase I)(GBSS-I Intergenic region (.165 kbps away from the gene) P8-Pr2
901.19 Ac 9 23275703 Forward GATGTTGCTGCTGTGTGTGG GRMZM2G171395
Putative NAM (No apical meristem) protein Intergenic region (2.76 kbps away from gene) P1-Pr36
923.33 Ac 9 23277982 Forward CAGGCCACCAAGTTTTGCTA GRMZM2G171395
Putative NAM (No apical meristem) protein Intergenic region (.559 kbps away from the gene) P10-PR18
921.01 Ac 9 23282262 Reverse
P8-Pr19
929.15 Ac 9 23282760 Reverse GAGGCGTAGATGGCCTTGTC GRMZM2G171395
Putative NAM (No apical meristem) protein Within the gene P12-Pr29
933.81 Ac 9 23282845 Forward GTGACCGATGCAGAGAAGTG GRMZM2G171395
Putative NAM (No apical meristem) protein Within the gene P9-Pr1
905.06 Ac 9 23282916 Forward CCATGGGACATCCAAGGTAG GRMZM2G171395
Putative NAM (No apical meristem) protein Within the gene P2-Pr20
929.45 Ac 9 23283003 Reverse GGACGGCAGAGGCATGTAT GRMZM2G171395
Putative NAM (No apical meristem) protein Part of the first intron and second exon within the gene P12-Pr18
905.54 Ac 9 23283035 Reverse GCGTGCGTAACAGCGTAGTA GRMZM2G171395
Putative NAM (No apical meristem) protein Within the gene P2-P36
917.17 Ac 9 23326655 Forward AAGGGGAAAGATCTGGAGGA GRMZM2G548053
No gene function listed Intergenic region (.452 kbps away from the gene) P9-Pr9
933.05 Ac 9 23326961 Reverse TAGCGACCAAACGTGAGCTT GRMZM2G548053
No gene function listed Intergenic region (.551 kbps away from the gene) P9-Pr2
916.04 Ac 9 23334179 Forward CCTTCCATATGCCCGTAACC GRMZM2G548056
Within the gene P67-Pr13
933.01 Ac 9 23343878 Forward
P12-Pr44
913.04 Ac 9 23457076 Forward
P5-Pr11
929.31 Ac 9 23459595 Forward CCGAGATATGAACGGTGACA GRMZM2G121333
Clone 353913 mRNA sequence Intergenic region (1.3 kbps away from the gene) P12-Pr6
905.63 Ac 9 23459927 Reverse TCGAGCCAACAACAAAGCTA GRMZM2G121333
Clone 353913 mRNA sequence Intergenic region (1.430 kbps away from gene) P2-Pr18
913.13 Ac 9 23459995 Forward
P5-Pr21
933.14 Ac 9 23460560 Reverse AGCGCCTTCTGTCTTCTTTG GRMZM2G121333
Clone 353913 mRNA sequence Intergenic region (1.966 kbps away from the gene) P9-Pr15
933.16 Ac 9 23460560 Reverse AGCGCCTTCTGTCTTCTTTG GRMZM2G121333
Clone 353913 mRNA sequence Intergenic region (1.966 kbps away from the gene) P9-Pr15
905.62 Ac 9 23467698 Reverse CTGAGGGATTCGTGCACTT GRMZM2G121333
Clone 353913 mRNA sequence Intergenic region (9.30 kbps away from gene) P2-Pr6
933.56 Ac 9 23530629 Reverse CTCACCTCAGGCCCTCACTC GRMZM2G396553
Full-length cDNA clone ZM_BFc0073O19 Intergenic region (.821 kbps away from the gene) P9-Pr30
913.33 Ac 9 23534885 Forward
P5-Pr8
913.01 Ac 9 23536375 Forward
P5-Pr4
913.18 Ac 9 23615991 Forward
P5-Pr15
916.02 Ac 9 24063293 Forward CGTCCGTCCGTCTCCCTAACT GRMZM2G082855
Putative uncharacterized protein Within the gene P67-Pr1
905.83 Ac 9 24453013 Forward AGACCCTGATGGAGTGCAAG GRMZM2G050418
Clone 400082 mRNA sequence Within the gene P2-Pr16
930.13 Ac 9 24467915 Reverse CCGTACAACTGTAACCCCAGA GRMZM2G050329
TSA: Zea mays contig21071, mRNA sequence Intergenic region ( .157 kbps away from the gene) P12-Pr35
929.37 Ac 9 24483122 Forward AACCGGCCAGTTTAGCTGAT GRMZM2G000909
Putative uncharacterized protein 14bps are found within exon 2, contains the stop (TAA) codon, and is part of the 3' UTR P12-Pr9
905.69 Ac 9 24485389 Reverse
P2-P45
905.54 Ac 9 24974659 Forward GCAAAAGAACCACTGAAAAACC GRMZM5G829436
Putative uncharacterized protein Within the gene P2-Pr10
933.5 Ac 9 25069671 Reverse ATGGCCTCATCAGGACACTC GRMZM2G029863
Putative uncharacterized protein Within the gene P9-Pr5
914.08 Ac 9 25084805 Reverse
P5-Pr29
929.35 Ac 9 25265666 Forward TACCTACCTGGGTGGTGAGC GRMZM5G825515_T05
Putative uncharacterized protein Part of the 5' UTR P12-Pr5
907.01 Ds 9 26623588 Forward
P3-Pr33
936.01 Ac 9 26714197 Reverse
P14-Pr22
905.98 Ac 9 26820033 Reverse GATGCTTGTTGCTTGTCGAA GRMZM2G475293
Putative uncharacterized protein Within the gene P2-Pr27
901.15 Ac 9 26826651 Forward CTGGGGTCAGTGCTGGTTAT GRMZM2G030216
Putative uncharacterized protein Within the gene P1-Pr14
933.71 Ds 9 26945197 Reverse CTACCAGGGATCCAGCAACT GRMZM2G066862
No gene function listed Within the gene P9-Pr33
919.21 Ac 9 26959944 Reverse TCTGCTCGGGATTGCCTAACTGT GRMZM2G156218
Putative uncharacterized protein Intergenic region (1.385 kbps away from gene) P67-Pr7
922.22 Ds 9 27015205 Forward
P10-PR30
917.29 Ac 9 27091429 Forward GRMZM2G084739
Putative uncharacterized protein Intergenic region (.589 kbps away from the gene) known 3'
906.17 Ac 9 27984945 Reverse
P3-Pr35
917.12 Ac 9 28042983 Forward GRMZM2G041668
ANAC076 Within the gene known 3'
913.25 Ac 9 31279277 Forward
P5-Pr10
913.03 Ac 9 32334453 Forward
P5-Pr5
913.41 Ac 9 32334453 Forward
P5-Pr5
913.51 Ac 9 32334453 Forward
P5-Pr5
913.12 Ac 9 32336782 Forward
P5-Pr9-2
902.11 Ds 9 3313604 Forward CACGTACGTCTCACCACCAC GRMZM2G136831
Putative uncharacterized protein Intergenic region (.766 kbps away from gene) P1-Pr12
902.35 Ds 9 34113646 Forward GCCTGCCATCTGACCTTAGT GRMZM2G319119
No gene function listed Intergenic region (28.43 kbps away from gene) P1-Pr16
911.24 Ac 9 38565905 Reverse
P5-Pr13*
913.03 Ac 9 39670460 Reverse
P5-Pr34
918.01 Ac 9 41517655 Reverse ATCAACGGCGCCAACTTCCTT GRMZM5G868431
No gene function listed Intergenic region (.057 kbps away from the gene) P67-Pr14
935.25 Ds 9 42841734 Forward
P14-Pr9
906.51 Ac 9 4339170 Reverse GGTGGGTGTACTGGGTAGGT GRMZM2G164072
Hypothetical protein LOC100277972 Intergenic region (2.030 kbps away from the gene) P3-Pr7
929.33 Ds 9 4398332 Forward AGCTGGACGAGAAGACGAAG GRMZM2G392306.
No gene function listed Found within exon 4 in the gene P12-Pr7
905.29 Ac 9 46651987 Reverse GRMZM2G134382
Putative uncharacterized protein Within the gene known 3'
901.04 Ac 9 58248619 Reverse GRMZM2G018612
Putative uncharacterized protein Within the gene 3'-end
922.06 Ds 9 7120164 Reverse TCAGTGCATGAACCAAAACC GRMZM5G814279
Putative uncharacterized protein Within the gene P10-PR24
919.36 Ac 9 8126569 Forward GTCACCAGCACGTCAGTGAG GRMZM5G870571
Putative uncharacterized protein Within the gene P67-Pr27
915.14 Ds 9 95601114 Forward
P5-Pr38*
914.11 Ac 9 96370810 Forward GRMZM5G887352
No gene function listed Intergenic region (14.115 kbps away from the gene) known 3'
931.08 Ac 10 110751838 Forward GCACGGATAAGGTCTAACACG GRMZM2G103725
Intergenic region (.576 kbps away from the gene) P12-Pr16
907.44 Ac 10 119560751 Forward GGATCGTGCCACACAAGTC GRMZM2G450913
No gene function listed 21 bps are part of an intergenic region in front of the gene, the remaining bases are part of the gene P4-Pr4
931.17 Ac 10 123811231 Reverse ACGAGCAAGTGTGAGTGAGC GRMZM2G064159_T02
Putative uncharacterized protein Within the 5' UTR region in the gene P12-Pr10
917.11 Ds 10 124580688 Reverse GATTACTGCACAGCGATCTCC GRMZM2G538283
Transcribed locus Intergenic region (2.443 kbps away from the gene) P9-Pr25
934.22 Ac 10 145571094 Reverse
P14-Pr17
931.29 Ac 10 146181887 Reverse TCCTTGTGTTCGTTCCACAG GRMZM2G006894
Proton-exporting ATPase Fragment (EC 3.6.3.6) Within the gene P12-Pr24
902.12 Ac 10 148094480 Forward GGCTTCGTCAGAACACTCCT GRMZM2G040876
Oligosaccharyl transferase STT3 subunit Within the gene P1-Pr17
914.19 Ac 10 2588141 Forward
P5-Pr3
914.14 Ac 10 2680473 Reverse
P5-Pr12
907.69 Ac 10 5118802 Reverse CATCCATGCCAGACAAGCTA GRMZM2G159179
Clone 1677983 mRNA sequence Intergenic region (3.395 kbps away from gene) P4-Pr14
905.05 Ds 10 6400025 Forward ACAACAAGCACGACCGGTAT GRMZM2G057753
No gene function listed Intergenic region (1.212 kbps away from gene) P2-P40
931.12 Ac 10 83458146 Reverse
P12-Pr43
933.51 Ds 10 8802750 Forward GCCACAAGGATCGATGGTAT GRMZM2G301124
No gene function listed Intergenic region (.041 kbps away from the gene P9-Pr11
905.96 Ds NSS in B73
P2-Xpr6
922.29 Ac NSS in B73
P10-PR8
923.05 Ac NSS in B73
P10-PR